Advanced search


Knowledge area




8 results, page 1 of 1

Síntesis y caracterización de nanopartículas de ZnO embebidas dentro de una matriz de SiO2 (SiO2/n-ZnONP/SiO2/p-Sisustrato) depositadas mediante sputtering reactivo

MARIO FRANCISCO AVILA MEZA (2019)

108 páginas. Doctorado en Ciencias e Ingeniería de Materiales.

Investigación realizada con el apoyo del Consejo Nacional de Ciencia y Tecnología (México). CONACYT.

Se realizó el depósito de nano partículas de óxido de zinc, confinadas en una matriz de dióxido de silicio a partir de blancos de zinc y silicio puros, sobre sustratos de silicio tipo p, utilizando la técnica de erosión catódica reactiva asistida por radio frecuencia sin tratamiento térmico posterior al depósito de los materiales. Se llevó a cabo la caracterización morfológica, química, pruebas físicas y mediciones eléctricas de las estructuras obtenidas. Se logró obtener una capa de SiO2 con rugosidad en el rango de nanómetros, sobre sustratos de silicio, controlando la presión parcial de oxígeno durante el proceso de erosión catódica. Las cuencas, propias de la rugosidad del material obtenido (SiO2), sirvieron para alojar el Zn metálico promoviendo su nucleación y su oxidación parcial en un espacio reducido a la escala de nanómetros. Posteriormente se logró la oxidación completa del Zn y su confinamiento al depositar otra capa de SiO2, obteniendo muestras con la estructura: sustrato de silicio tipo p, óxido de silicio, nano partículas de óxido de zinc tipo n y una segunda capa de óxido de silicio: SiO2/n-ZnONP/SiO2/p-Sisustrato. Primero se analiza la morfología superficial de las muestras por medio de microscopías de fuerza atómica, de barrido y de transmisión. También se realizó difracción de rayos X, espectroscopía de luz visible y UV. Se demuestra la composición de dióxido de silicio de la primera capa depositada por medio de espectroscopía de infrarrojo. Se obtiene la presencia y distribución de partículas de Zn a través de espectroscopía por energías dispersadas de rayos X y por espectroscopía de masas de iones secundarios. Posteriormente se confirma la presencia del compuesto estequiométrico de ZnO por medio de espectroscopía de foto electrones emitidos por rayos X. Se confirma la presencia de partículas de ZnO con tamaño <10 nm con estructura cristalina hexagonal por medio de microscopía electrónica de transmisión. Finalmente, se demuestra el comportamiento rectificante, típico de una unión p-n, y su respuesta eléctrica a la luz por medio de mediciones corriente-voltaje, en régimen de iluminación y obscuridad. Se evidencía la variación de sus características eléctricas al estímulo de diferentes longitudes de onda por medio de la técnica de respuesta espectral.

The synthesis of zinc oxide nanoparticles, confined in a matrix of silicon dioxide from pure zinc and silicon targets, on a p-type silicon substrate was carried out. The technique of reactive cathodic erosion assisted by radio frequency without heat treatment after the deposit of the materials was used. The morphological, chemical, physical and electrical characterization of the structures obtained was carried out. It was possible to obtain a layer of SiO2 with roughness in the range of nanometers, on silicon substrates, controlling the partial pressure of oxygen during the process of cathodic erosion. The basins, typical of the roughness of the material obtained, served to house the metallic Zn, promoting its nucleation and its partial oxidation in a space reduced to the scale of nanometers. Subsequently, the complete oxidation of Zn and its confinement was achieved by depositing another layer of SiO2, obtaining samples with the structure: the p-type silicon substrate, a thin-roughness film of silicon oxide, n-type zinc oxide nanoparticles and finally a second layer of silicon oxide which completed the matrix; SiO2/n-ZnONP/SiO2/p-Sisustrate. First, the surface morphology of the samples is analyzed by atomic force, scanning and transmission microscopy, X-ray diffraction, and UV-visible light spectroscopy. The silicon dioxide composition of the first deposited layer is demonstrated by infrared spectroscopy. The presence and distribution of Zn particles were obtained through spectroscopy by scattered X-ray energies and by secondary ion mass spectroscopy. Subsequently, the presence of the stoichiometric ZnO compound is confirmed by X-ray photoelectric electron spectroscopy. The presence of ZnO particles with size <10 nm with hexagonal crystalline structure is evidenced by transmission electron microscopy. Finally, the rectifying behavior, typical of a p-n junction, and its electrical response to light by means of current-voltage, measurements in lighting and dark regime is demonstrated. The variation of its electrical characteristics to the stimulus of different wavelengths is evidenced by the spectral response technique.

Doctoral thesis

Nanostructured materials. Zinc oxide. Nanocrystals--Synthesis. Semiconductor nanocrystals. Materiales nanoestructurados. Óxido de cinc. Nanocristales semiconductores. TA418.9.N35 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS SÍNTESIS QUÍMICA

Síntesis y caracterización de óxido de grafito funcionalizado con derivados y análogos de o-fenilendiamina. Obtención de bencimidazoles

MARIA VICTORIA BARRERA PASCUAL (2016)

128 páginas. Maestría en Ciencias e Ingeniería de Materiales.

Investigación realizada con el apoyo del Consejo Nacional de Ciencia y Tecnología (México). CONACYT.

Los materiales a base de carbono han sido estudiados recientemente debido a sus potenciales propiedades y posibles aplicaciones en el campo de la física, química, electrónica y mecánica. Un derivado del grafito es el óxido de grafito el cual si bien fue descubierto hace más de un siglo ha despertado gran interés ya que no solo ha resultado ser un precursor de bajo costo para la obtención de grafeno a gran escala si no que los grupos oxigenados del óxido de grafito han permitido funcionalizarlo covalentemente en presencia de precursores que contienen nitrógeno tales como aminas orgánicas. La funcionalizacion covalente del óxido de grafito seguido de una reducción ha logrado ser una forma eficaz de modificar su estructura química y modular sus propiedades eléctricas. Pocas investigaciones se han centrado en el estudio del óxido de grafito funcionalizado no reducido, esto provoca el interés que se tiene por estudiar el proceso de funcionalizacion para lo cual se introdujeron una serie de compuestos orgánicos con grupos amino los cuales permitieron por medio de una reacción de ciclación la formación de bencimidazoles en la estructura del óxido de grafito. El presente trabajo tuvo como objetivo funcionalizar oxido de grafito con análogos y derivados de o-fenilendiamina previamente sintetizados además de servir como precursores para la obtención de bencimidazoles disubstituidos. La síntesis de derivados de o-fenilendiamina partió de o-nitroanilina y o-fenilendiamina con 2-cloropiridina y 2-cloropirimidina respectivamente. Las reacciones fueron efectuadas de manera convencional y asistida por horno de microondas, la caracterización de los productos se realizó por Resonancia Magnética Nuclear de 1H, 13C en equipo BRUKER de 400MHz con DMSOd6 como disolvente y espectroscopia de Infrarrojo por transformada de Fourier los cuales se realizaron en estado sólido en un equipo BRUKER FT-IR ALPHA en el modo de Reflectancia total atenuada. (ATR). Previo a la funcionalizacion el grafito fue oxidado por el Método de Hummers modificado tratándolo con KMnO4 y H2SO4, y posteriormente con H2O2. La funcionalizacion se realizó por ultrasonido con una dispersión de óxido de grafito en agua desionizada, posteriormente se adicionaron los compuestos orgánicos diluidos con etanol en presencia de ácido polifosforico como catalizador y la suspensión fue calentada por 24hrs. Se caracterizaron los materiales por las técnicas de Difracción de Rayos X, Análisis termogravimétrico, espectroscopia de Infrarrojo por transformada de Fourier, Raman y Microscopia Electrónica de Barrido con espectroscopia de energía dispersiva. Finalmente, se evaluó el rendimiento electroquímico de los materiales funcionalizados no reducidos utilizando la técnica de Voltamperometría Cíclica. Se impregno oxido de grafito con nafión en un electrodo de carbón vítreo utilizado como electrodo de trabajo, un alambre de platino como electrodo auxiliar y uno de plata como electrodo de referencia en una solución acuosa 1M de H2SO4 como electrolito. Los resultados de los óxidos de grafito funcionalizados indican valores de capacitancia especifica hasta ciento cincuenta veces mayores en comparación con el óxido de grafito no funcionalizado.

In recent years, carbon-based materials have been studied because of its potential properties and potential applications in the field of physics, chemistry, electronics and mechanics. A derivative of graphite is graphite oxide which although it was discovered over a century has aroused great interest since not only proved to be a precursor of low cost for obtaining graphene on a large scale if the oxygenated groups graphite oxide have allowed covalently funcionalizarlo in the presence of nitrogencontaining precursors such as organic amines. Covalent functionalization graphite oxide followed by reduction achieved be an effective way to modify their chemical structure and modulate its electrical properties. Few studies have focused on the study of oxide functionalized graphite unreduced, this causes the interest is to study the process of functionalization for which a number of organic compounds with amino groups which enabled by a reaction introduced cyclization formation benzimidazoles in the oxide structure of graphite. This work aims to functionalize graphite oxide analogs and derivatives o-phenylenediamine previously also serve as precursors for obtaining disubstituted benzimidazoles synthesized. Synthesis of o-phenylenediamine derivatives of o-nitroaniline left and o-phenylenediamine with 2-chloropyridine and 2-chloropyrimidine respectively. The reactions were carried out in conventional manner and microwave, characterization involved the determination of the melting points on a Fisher-Johns, Nuclear Magnetic Resonance 1H, 13C BRUKER 400MHz computer with DMSO-d6 as solvent and Infrared device transform Fourier which were performed in the solid state on a Bruker FT-IR ALPHA. Prior to functionalization graphite was oxidized by the method of treating the graphite Hummers modified with KMnO4 and H2SO4, and subsequently H2O2. Functionalization was carried sonicating oxide dispersion in deionized water graphite subsequently diluted organic compounds in small amounts of ethanol in the presence of polyphosphoric acid as catalyst and the suspension was heated for 24hrs were added. To better understand the process prior to functionalization reduction materials were characterized by the techniques of Fourier Transform Infrared, Raman, X-ray diffraction, thermogravimetric analysis and scanning electron microscopy. Finally electrochemical performance of the functionalized materials unreduced using Cyclic voltammetry technique is evaluated. graphite oxide with Nafion was impregnated in a glassy carbon electrode used as working electrode, a platinum wire as the auxiliary electrode and one silver as a reference electrode in a 1M aqueous H2SO4 solution as electrolyte. The results of oxides functionalized graphite indicate specific capacitance values up to fifty times greater in percent compared to graphite oxide unfunctionalized.

Other

Master Degree Work

Óxido de grafito, funcionalizacion covalente, fenilendiaminas N-sustituidas, bencimidazol, piridinas 2-sustituidas. Graphite oxide, covalent functionalization, benzimidazole, 2-substituted pyridines, phenylenediamines N-subst1. Carbon. Graphene--Oxidation. Benzimidazoles--Synthesis. Nanostructured materials. Carbono. Grafeno. Materiales nanoestructurados. TA455.C3 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS QUÍMICA DEL CARBONIO

Organocatalytic cascade reaction for the synthesis of polycylic compounds utilizing Trienamine activation

SUHAS BALASAHEB MITKARI (2021)

We report an Aminocatalytic privileged Diversity-Oriented Synthesis (ApDOS) strategy via trienamine catalysis for the construction of diverse and complex thiopyrans-piperidone fused rings through a thia-Diels–Alder/nucleophilic ring closing sequence by using dithioamides as activated heterodienophiles. Following this strategy, a super cascade reaction to assemble nine fused rings can be achieved by employing a bis-dithioamide. Additionally, by linking an indole moiety on the dithioamide, a Pictet-Spengler type reaction can be promoted once the cascade sequence has been achieved, leading to more complex penta- hexa- and heptacyclic fused ring derivatives in a one-pot process. This investigation, open new perspectives for the synthesis of a new class of complex and diverse thiopyrans, which contribute to populate new relevant regions in the chemical space.

Doctoral thesis

CGU- Doctorado en Química BIOLOGÍA Y QUÍMICA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS Organocatalytic cascade reaction Polycylic compounds – Synthesis Trienamine - Activation

Aplicación de la aminocatálisis en la síntesis estereoselectiva de compuestos cíclicos altamente funcionalizados a través del modo de activación trienamina

JESSICA ROSARIO GUTIERREZ CANO (2019)

En la presente disertación se describe la aplicación de la organocatálisis asimétrica en reacciones de cicloadición [4+2] a través del modo de activación trienamina. Dicho intermediario trienamina, se generó a través de la condensación de un aminocatalizador quiral con 2,4-dienales, adquiriendo el carácter de un dieno, el cual mediante una reacción del tipo Diels-Alder con diferentes dienófilos, dio como resultado la síntesis de cicloaductos con cierto grado de estereocontrol. Por lo anterior, en el presente proyecto se expone una metodología de síntesis para la obtención de una pequeña familia de derivados tetrahidrocarbazólicos y de tipo ciclohexeno funcionalizados a través de la estrategia de aminocatálisis asimétrica. El empleo de aminas secundarias quirales como catalizadores permitió observar una ostensible estereoselectividad en la reacción. Sin embargo, la reactividad de los 2,4-dienales evaluados nos permitió identificar algunas limitaciones en nuestra metodología. Del mismo modo, se investigó la posibilidad de funcionalizar los productos de cicloadición enantioméricamente enriquecidos, a través de una serie de transformaciones químicas con la finalidad de obtener estructuras moleculares de interés sintético, abriendo paso a su posible aplicación como bloques de construcción.

In the present dissertation,the application of organocatalytic [4 + 2] cycloaddition reactions through trienamine activation mode is described. The trienamine intermediate was generated by condensation of achiral aminocatalyst with 2,4-dienals, acquiring the character of a diene, which by Diels-Alder reaction with different dienophiles, gave the synthesis of cycloadducts with a certain degree of stereo control. Therefore, in this project we present asynthetic methodology for obtaining a small family of functionalized tetrahydrocarbazole and cyclohexene derivatives through the asymmetric aminocatalysis strategy. The use of chiral secondary amines as catalysts allowed to observe an evident stereoselectivity in there action. However, the reactivity of the 2,4-dienals evaluated allowed us to identify some limitations of our methodology. In the same way, we also investigated functionalization possibilities of our enantioenriched cycloaddition products through aseveral chemical transformations in order to furnish molecular structures with synthetic interest, opening the way to their possible application as building blocks.

Master thesis

BIOLOGÍA Y QUÍMICA QUÍMICA QUÍMICA ORGÁNICA Aminocatálisis asimétrica Compuestos cíclicos - Síntesis estereoselectiva Tetrahidrocarbazólicos - Derivados Ciclohexeno - Derivados Hidrocarburos – Funcionalización Asymmetric aminocatalysis Cyclic Compounds - Stereoselective Synthesis Tetrahydrocarbazoles - Derivatives Cyclohexene - Derivatives Hydrocarbons - Functionalization

Microwave-assisted synthesis of the lipase-catalyzed ring-opening copolymerization of ε-caprolactone and ω-pentadecanolactone: Thermal and FTIR characterization

WILBERTH ANTONIO HERRERA KAO Manuel de Jesús Aguilar Vega JOSE MANUEL CERVANTES UC (2020)

Microwave-assisted synthesis of the lipase-catalyzed ring opening polymerization of ε-caprolactone (ε-CL) and ω-pentadecanolactone (ω-PDL) monomers was studied. A series of P(CL-co-PDL), with different molar feed ratios, including (ε-CL/ω-PDL) 100/0, 75/25, 50/50, 25/75, and 0/100, were synthesized. The resulting polyesters were characterized by Fourier transform infrared spectroscopy (FTIR), differential scanning calorimetry (DSC), and thermogravimetric analysis (TGA). The microwave-assisted polymerization of the monomers reached high conversions (91–95%) within 60 min. FTIR spectra showed the typical absorption bands of these polyesters. A very intense band in the carbonyl region, which was shifted from 1,720 cm−1 for PCL to 1,732 cm−1 for PPDL homopolymer, as well as peaks owing to methylene groups in the 2,990–2,850 cm−1 range. DSC results revealed that all polyester samples were semi-crystalline. Interestingly, the copolymers exhibited only one melting peak (Tm), and their Tm values linearly increased from 57°C to 95°C as PPDL concentration was increased. Thermal stability of polyesters also depended on PDL content; an increase in PDL concentration increases polymer degradation temperature (Td).

Article

MICROWAVE-ASSISTED SYNTHESIS LIPASE-CATALYZED RING-OPENING POLYMERIZATION COPOLYESTERS ω-PENTADECANOLACTONE ε-CAPROLACTONE INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS TECNOLOGÍA DE MATERIALES PROPIEDADES DE LOS MATERIALES PROPIEDADES DE LOS MATERIALES

Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

BLANCA ESTELA CHAVEZ SANDOVAL (2015)

106 páginas. Doctorado en Ciencias e Ingeniería Ambientales.

El auge por la utilización de nanopartículas (NPs) de metales nobles en diversos campos, ha derivado en la síntesis inorgánica de NPs metálicas, sin embargo, las metodologías utilizadas para su obtención son generalmente costosas e involucran el uso de químicos peligrosos, es por ello que recientemente ha aumentado el desarrollo de alternativas sustentables y amigables con el ambiente. Sintetizar AuNPs biológicamente es un procedimiento simple, poco costoso y menos perjudicial para el ambiente. El uso de extractos de plantas para la síntesis de nanomateriales aún no se ha explorado completamente, sin embargo, representa una buena alternativa ya que además de las ventajas antes mencionadas se obtienen NPs estables de diferente tamaño y forma. En este trabajo se realizó la síntesis y caracterización de AuNPs, así como su funcionalización con sondas específicas de DNA de dos microorganismos de interés ambiental Achlya sp. y Escherichia coli (E. coli). Achlya sp. es un hongo que infecta peces en piscifactorías, acuarios y embalses naturales; E coli, es una bacteria patógena para los humanos y constituye una fuente de contaminación en alimentos y agua. La sonda o secuencia blanco diseñada para Achlya sp. es: 5’GCACCGGAAGTACAGACCAA3’ y para E.coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ Las AuNPs obtenidas por síntesis química y por síntesis biológica a partir de extractos de laurel, nopal, cebolla, pera y café, fueron funcionalizadas con DNA de Achlya sp. y E. coli y pueden ser utilizadas en el diseño y construcción de biosensores ambientales para detectar a los microorganismos antes mencionados, excepto las NPs de café a pH 9, ya que estas no mostraron mediante caracterización por UV-Vis, una buena funcionalización. Por otro lado, se propone que, para la síntesis biológica, el ácido málico puede estar actuando como agente reductor y el grupo amino como agente estabilizador. Los genosensores permiten monitorear, prevenir y corregir aspectos que causan desequilibrios ecológicos en ambientes acuáticos. Estos nuevos dispositivos analíticos proporcionan información de forma rápida, simple y de bajo costo, comparada con las técnicas de análisis convencionales.

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

Doctoral thesis

Organic compounds--Synthesis. Transition metal catalysts. Nanostructured materials--Synthesis. Green chemistry. Síntesis orgánica. Catalizadores metálicos. QD262 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS PROCESOS QUÍMICOS

ZIF’s como soporte catalítico y fuente primaria de carbono en la síntesis de materiales nanoestructurados de carbono y su aplicación en el almacenamiento de hidrógeno

MARIA JOSE MARTIN MARTINEZ (2020)

113 páginas. Maestría en Ciencias e Ingeniería de Materiales.

Investigación realizada con el apoyo del Consejo Nacional de Ciencia y Tecnología (México). CONACYT.

En la actualidad, el uso desmedido de los combustibles fósiles, debido al crecimiento de la población, ha provocado problemas ambientales severos, como lo es el calentamiento global. Por ello, la búsqueda de nuevos combustibles limpios como el metanol e hidrógeno ha tenido un gran crecimiento, principalmente en el almacenamiento de este último. En el presente trabajo se planteó la síntesis verde de diferentes materiales ZIFs (ZIF-67, basados en Co y Ni); estos materiales, debido a sus propiedades, son competentes para el almacenamiento de hidrógeno y, además, como catalizadores en la síntesis de nanotubos de carbono. Se estudiaron tres tipos de síntesis verdes, con la finalidad de disminuir los contaminantes que se pueden generar en el proceso; el método hidrotermal, método ionotermal (usando un solvente eutéctico profundo) y el método mecanoquímico (solamente el método hidrotermal está reportado en la literatura para la síntesis de este material). Posteriormente, a estos materiales sintetizados se les realizaron pruebas para evaluar su eficiencia en el almacenamiento de hidrógeno. Por último, los ZIFs sintetizados se emplearon en el crecimiento de nanotubos de carbono por el método CVD, donde estos ZIFs se usaron como una fuente primaria de carbono. Finalmente, todos los materiales sintetizados (ZIFs y NTCs) fueron caracterizados por diferentes técnicas analíticas tales como: Difracción de rayos-X, espectroscopia FT-IR, espectroscopia Raman, microscopia electrónica de barrido, espectroscopia de rayos-X dispersivos y por fisisorción de nitrógeno. Para el caso del almacenamiento de hidrógeno los ZIF-67(Co) sintetizados por los métodos hidrotermal e ionotermal obtuvieron los mejores resultados (4.74% y 3.04%, respectivamente).

Master thesis

Nanoparticles--Environmental aspects. Nanostructured materials--Synthesis. Nanochemistry. Green chemistry. Química verde. Materiales nanoestructurados. Nanotubos. TA418.9.N35 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS TECNOLOGÍA DE LA CATÁLISIS

Investigación sobre diseño de amplificadores de potencia clase F

Research about design of class F power amplifiers

Manuel Cruz Soriano (2021)

Con la creciente demanda de los sistemas de comunicaciones y el rápido desarrollo de la tecnología 5G, se deben diseñar dispositivos que logren una buena relación entre eficiencia, tasa de transmisión de datos y costos de operación, además de poder operar en RF. Uno de los dispositivos que pueden cumplir con estas características y que es parte importante de los sistemas de comunicación, es el amplificador de potencia. Los amplificadores de potencia pueden ser altamente eficientes y entregar a la salida del dispositivo una alta potencia; esto dependiente de la clase de operación y la tecnología del dispositivo activo usado en el diseño. El amplificador de potencia clase F es un fuerte candidato para cumplir con todos éstos requisitos, puesto que puede entregar alta eficiencia y alta potencia de salida, si se logra obtener la forma de onda de voltaje cuadrada y la forma de onda semi-sinusoidal rectificada para la corriente en el plano intrínseco. En este trabajo de tesis se estudió al amplificador de potencia clase F y se propuso un diseño a 2 GHz como frecuencia de operación. El método de diseño contempló el uso del modelo no lineal de un transistor AlGaN/GaN HEMT, la obtención de la carga óptima usando el sistema de Load-Pull y la síntesis de las redes de carga y acoplamiento a la salida del amplificador, además de un análisis en los diferentes planos de medición del transistor. El modelado del transistor GaN se realizó mediante un circuito eléctrico equivalente y un modelo no lineal. Para el diseño de la red de carga se siguió la teoría del amplificador clase F, la cual establece que se debe presentar un corto circuito para el segundo armónico y un circuito abierto para el tercer armónico. Sin embargo, en la práctica se demuestra que estas condiciones son muy difíciles de alcanzar, en especial el circuito abierto para el tercer armónico. Pero queda demostrado en este trabajo de tesis, que aun sin alcanzar completamente estas condiciones, es posible obtener un amplificador de potencia clase F con una alta eficiencia y un buen nivel de potencia de salida.

With the increasing demand of communication systems and fast development of 5G technology, devices must be designed to create a good relation between efficiency, data transmission rate and operating costs, beside being able to operate at RF frequencies. One of these devices that can fulfill with these characteristics and which is an important part of the communication systems, is the power amplifier. The power amplifiers can be highly efficient and give at the output a high power; this depends on the operation class and the active device technology used in the design. The class F power amplifier is a strong candidate to satisfy all these requirements, since, it can give a high efficiency and output power, if square voltage waveforms and a rectified semi-sinusoidal waveform for the current can be obtained in the intrinsic plane. In this thesis work the class F power amplifier is studied and a 2 GHZ operation frequency is considered. The design method considers the use of an AlGaN/GaN HEMT nolinear model transistor, obtaining the optimal load using the Load-Pull system and the synthesis of load and matching networks to the amplifier output, also an analysis in the different reference planes of the transistor is performed. The GaN transistor modeling, is done through an equivalent electric circuit and nolinear model. For the load network design, class F amplifier theory was followed, in which stablishes that a short circuit must be present for the second harmonic and an open circuit for the third harmonic. However, in practice those conditions are hard to reach specially for the open circuit of the third harmonic. But it is proved, in this thesis work, that even when it is not possible to reach at the optimal conditions is possible to get a class F power amplifier with a high efficiency and a good level of power output.

Master thesis

Amplificador clase F, modelado no lineal, planos de medición, síntesis de redes de carga, alta eficiencia, potencia de salida Class F amplifier, nonlinear modeling, reference planes, synthesis of load networks, high efficiency, output power INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS TECNOLOGÍA DE LAS TELECOMUNICACIONES DISEÑO DE CIRCUITOS DISEÑO DE CIRCUITOS