Advanced search


Knowledge area




9 results, page 1 of 1

The body of knowledge

Lourdes Pacheco (2021)

In the present paper discusses the exclusion of the body performed by modern science and tradition in the body of scientific knowledge became an epistemological obstacle. Women were considered structured by the body, desires and pulsions in both men were self-rated as marked by reason, objectivity and neutrality. The incorporation of women in science led him to discuss the tenets of science, the silencing of the body and the recognition of subjectivity. Knowledge from the bodies of women set out another way to know. Violate the legitimacy of science male domination because their construction process does not occur in the separation of the world, but in proximity to him.

Article

Artículo

Epistemology body feminism Epistemología cuerpo feminismo CIENCIAS SOCIALES CIENCIAS SOCIALES

The production of precarious bodies by the racialization dispositive

Erika Saccucci (2021)

This article approaches the production of bodies in three land possession conflicts in the city of Córdoba, Argentina: Piedra Blanca, Pueblos Unidos and 12 de Septiembre. The bodies are effects of the intersection between power mechanisms, tactics and strategies of the subjects in struggle. We conducted 35 in-depth interviews and a content analysis with some discourse analysis tools. The analysis shows that the deployed main device over these bodies is the racialization that produces a greater exposure of those bodies to precariousness. At the same time, the tactics and strategies that subjects go against the device have been also analyzed. Finally, we analyze the performance of those precarious bodies, characterized by the preeminence of a racialization dispositive that involves a process of alterification and unequal distribution and administration of that exposure to precariousness.

Article

Artículo

bodys tactics strategys social conflict power cuerpos tácticas estrategias conflicto social poder CIENCIAS SOCIALES CIENCIAS SOCIALES

Color pattern and body size variation in live Aspidoscelis costatus costatus (Squamata: Teiidae) from a protected enclave in southern Mexico

ALDO GOMEZ BENITEZ Oswaldo Hernández Gallegos Brittany Lovell Pelagie Kadia JAMES MARTIN WALKER (2020)

Coloración en la lagartija Aspidoscelis costatus costatus

Whiptail lizards in the sexlineatus species group (genus Aspidoscelis) in North America represent some of the most challenging patterns of variation in the North American herpetofauna. The range of color patterns in these populations is based on individual, ontogenetic, sexual, seasonal, and/or geographic variation. We studied representatives of a population of Western Mexico Whiptail (A. costatus costatus) from a protected private enclave of approximately 0.27 ha in the municipality and city of Ixtapan de la Sal, Estado de México, México. We captured 50 lizards in 2016 and 24 in 2018, most of which we photographed ex situ and a few in situ. These photographs revealed that a variety of age/size related dorsal and ventral patterns were consistently present. Males progressed through five stages of dorsal pattern changes from pale stripes, dark intervening fields, no spots to spots, and diverse pale configurations set in a black ground color. Females in this population showed similar changes but did not lose striping as they grew. Ontogenetic changes in ventral color patterns were also apparent, with males becoming more colorful than females. The adaptive significance of extensive color pattern variation in this urban population of A. c. costatus warrants further study.

Article

adaptive significance Balsas Basin Whiptail body size dorsal coloration Mexican lizards ontogeny spots stripes ventral coloration BIOLOGÍA Y QUÍMICA

Yield estimation of forage oat (Avena sativa L.) Chihuahua variety: ruler and plate methods.

SERGIO IBAN MENDOZA PEDROZA PERPETUO ALVAREZ VAZQUEZ ELISEO SOSA MONTES MARIA DE LOS ANGELES MALDONADO PERALTA JONATHAN RAUL GARAY MARTINEZ (2021)

Objetive: To analyze forage estimations with the direct method and the plant height.

Design/methodology/approach: The treatments were the plants age, assessed in a random block design. Simple linear

regressions were carried out and adjusted using the SPSS statistical software.

Article

Estimation methods plant height forage yield CIENCIAS AGROPECUARIAS Y BIOTECNOLOGÍA CIENCIAS AGRARIAS OTRAS ESPECIALIDADES AGRARIAS

Estimation of radiated energy using the EGF technique: what should be the upper limit of integration in the frequency domain?

Shri Krishna Singh (2007)

The empirical Green's function (EGF) technique is frequently used to estimate the radiated seismic energy, ER, of an earthquake. An approximation of the moment-rate spectrum, M0(f), of the target earthquake is obtained from the ratio of the spectrum of the target earthquake to the spectrum of the EGF earthquake, and the radiated seismic energy is computed by integrating f2M0 2(f) over frequency f. The choice of the upper limit of integration, fu, is critical. In this note we show that the optimum choice of fu, for the ω2-source model is given by fu/fc1∼ fc2/fc1, where fc1 and fc2 are the corner frequencies of the target and the EGF earthquakes, respectively. This result provides a useful guide in the application of the EGF technique to obtain a reliable estimate of the radiated seismic energy.

Article

TERREMOTOS ANÁLISIS EMPÍRICO MÉTODO DE ESTIMACIÓN FUNCIÓN VERDE ANÁLISIS DE FIABILIDAD SISMICIDAD Earthquake Empirical analysis Estimation method Green function Reliability analysis Seismicity CIENCIAS FÍSICO MATEMÁTICAS Y CIENCIAS DE LA TIERRA CIENCIAS DE LA TIERRA Y DEL ESPACIO GEOFÍSICA SISMOLOGÍA Y PROSPECCIÓN SÍSMICA concept8601 Seismology

Other masculinity: Body and dance practices

Karla Jeanette Chacón Reynosa Raquel Hernández Gómez (2016)

The main objective of this article is to identify and analyze the exercise of corporal practices of young men that execute scenic dance in terms linking / separation of what incarnate as men. In the analysis of the constitution from non-hegemonic masculinities dance, we offer three body itineraries are a real cultural field in which confrontations rise to traditional models of masculinity and emerges from them a display of “other practices”: poor, weak, unstable to (re) construct the masculine; This (re) construction fortifies on the performative field of dance, once regarded as a space “feminized” to recognize and resignifying as sand body transformation and embodiment of other male practices: their affections, development of aesthetic appreciation, care physical and bodily experience.

Article

Artículo

Body practices itineraries dance masculinity Prácticas corporales itinerarios danza masculinidades CIENCIAS SOCIALES CIENCIAS SOCIALES

Body Mass Index in Pregnancy Does Not Affect Peroxisome Proliferator-activated Receptor Gamma Promoter Region (-359 to -260) Methylation in the Neonate

RUTH ELIZABETH CASAMADRID VAZQUEZ ARACELI AMAYA CHAVEZ Hugo Mendieta Zerón (2016)

Background: Obesity in pregnancy can contribute to epigenetic changes. Aim: To assess whether body mass index (BMI) in pregnancy is associated with changes in the methylation of the peroxisome proliferator‑activated receptor γ (PPAR) promoter region (−359 to − 260) in maternal and neonatal leukocytes. Subjects and Methods: In this matched, cohort study 41 pregnant women were allocated into two groups: (a) Normal weight (n = 21) and (b) overweight (n = 20). DNA was extracted from maternal and neonatal leukocytes (4000–10,000 cells) in MagNA Pure (Roche) using MagNA Pure LC DNA Isolation Kit 1 (Roche, Germany). Treatment of DNA (2 μg) was performed with sodium bisulfite (EZ DNA Methylation‑Direct™ Kit; Zymo Research). Real‑time quantitative polymerase chain reaction (qPCR) was performed in a LightCycler 2.0 (Roche) using the SYBR® Advantage® qPCR Premix Kit (Clontech). The primers used for PPARg coactivator (PPARG) M3 were 5’‑aagacggtttggtcgatc‑3’ (forward), and5’‑cgaaaaaaaatccgaaatttaa‑3’ (reverse) and those for PPARG unmethylated were: 5’‑gggaagatggtttggttgatt‑3’ (forward) and 5’‑ttccaaaaaaaaatccaaaatttaa‑3’ (reverse). Intergroup differences were calculated using the Mann–Whitney U‑test, and intragroup differences, with the Wilcoxon test (IBM SPSS Statistics for Windows, Version 19.0. Armonk, NY: IBM Corp.). Results: Significant differences were found in BMI, pregestational weight, and postdelivery weight between groups but not in the methylation status of the PPARγ promoter region (−359 to − 260). Conclusion: The PPARγ promoter region (−359 to − 260) in peripheral leukocytes is unlikely to get an obesity‑induced methylation in pregnancy.

Acknowledgments Authors thank the National Council of Science and Technology (CONACYT), México, for the MSc. Scholarship awarded to Ruth Elizabeth Casamadrid Vázquez and Maggie Brunner M.A., for her excellent help with the English style correction. Financial support and sponsorship National Council of Science and Technology (CONACYT), Mexico and Asociación Científica Latina A.C (ASCILA).

Article

Body mass index Methylation Peroxisome proliferator‑activated receptor gamma Pregnancy MEDICINA Y CIENCIAS DE LA SALUD

Sonificación interactiva de movimientos para cambiar la percepción corporal: el caso de estudio de yoga

Interactive sonification of movements to change body perception: the case study of yoga

María Concepción Valdez Gastelum (2021)

La sonificación interactiva es un tipo de sonificación que provee una retroalimentación auditiva sobre un conjunto de información resultada de una interacción. Dicho conjunto de información representa datos obtenidos de diversos tipos de dispositivos o sensores, por ejemplo, ángulos de movimiento de las partes del cuerpo mediante una cámara de profundidad. La retroalimentación auditiva se conoce como interacción sonora y ésta se realiza mediante la asociación de las características sonoras (p.ej., tono, timbre) con los datos sensados. Las interacciones sonoras pueden apoyar a la práctica de actividades físicas aportando una guía de movimientos. También, mediante la manipulación de las características sonoras que conforman dicha interacción, es posible cambiar la percepción corporal durante la práctica de actividades físicas. En particular, es importante tener una percepción corporal positiva durante la práctica de yoga ya que esto ayuda a tener una relación más armónica entre cuerpo y mente, y con ello adaptar las prácticas físicas a necesidades individuales. En esta tesis se presenta el diseño de Zens, una interfaz sonificada la cual mediante interacciones sonoras mejora la experiencia de una práctica de yoga. Por otro lado, mediante la manipulación de la variación de frecuencia busca cambiar la percepción corporal y de flexibilidad de los yoguis. Para evaluar la efectividad de Zens en los términos mencionados anteriormente, se realizó una evaluación donde participaron 12 yoguis principiantes. Todos los yoguis realizaron una sesión de yoga, la mitad de ellos utilizando Zens y la otra mitad de manera tradicional siguiendo el sonido de la respiración. Los resultados indican que Zens genera una mejor experiencia de la práctica de yoga, en particular brindan un sentimiento de logro e interés a los yoguis. Además, los resultados obtenidos muestran que no existe un cambio en la percepción de flexibilidad y percepción corporal al variar la frecuencia de las estructuras sonoras.

Interactive sonification is a type of sonification that provides auditory feedback on a set of information resulting from an interaction. This set of information represents data obtained from various types of devices or sensors, for example, angles of movement of body parts using a depth camera. Auditory feedback is known as sound interaction and this is done by associating sound characteristics (e.g., pitch, timbre) with sensed data. Sound interactions can support the practice of physical activities by providing a guide to movements. Also, by manipulating the sound characteristics that make up this interaction, it is possible to change body perception during the practice of physical activities. In particular, it is important to have a positive body perception during the practice of yoga as this helps to have a more harmonious relationship between body and mind, and thereby adapt physical practices to individual needs. This thesis presents the design of Zens, a sonified interface which through sound interactions improves the experience of a yoga practice. On the other hand, by manipulating frequency variation it seeks to change the body perception and flexibility of yogis. To evaluate the effectiveness of Zens in the terms mentioned above, an evaluation was conducted where 12 beginner yogis participated. All the yogis performed a yoga session, half of them using Zens and the other half in a traditional way following the sound of the breath. The results indicate that Zens generates a better experience of yoga practice, in particular providing a feeling of accomplishment and interest to yogis. In addition, the results obtained show that there is no change in the perception of flexibility and body perception by varying the frequency of sound structures.

Master thesis

Sonificación Interactiva, Percepción Corporal, Yoga, Flexibilidad, Variación de Frecuencia Interactive Sonification, Body Perception, Yoga, Flexibility, Dynamic Pitch INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS TECNOLOGÍA DE LOS ORDENADORES ENSEÑANZA CON AYUDA DE ORDENADOR ENSEÑANZA CON AYUDA DE ORDENADOR