Advanced search


Knowledge area




10 results, page 1 of 1

The production of precarious bodies by the racialization dispositive

Erika Saccucci (2021)

This article approaches the production of bodies in three land possession conflicts in the city of Córdoba, Argentina: Piedra Blanca, Pueblos Unidos and 12 de Septiembre. The bodies are effects of the intersection between power mechanisms, tactics and strategies of the subjects in struggle. We conducted 35 in-depth interviews and a content analysis with some discourse analysis tools. The analysis shows that the deployed main device over these bodies is the racialization that produces a greater exposure of those bodies to precariousness. At the same time, the tactics and strategies that subjects go against the device have been also analyzed. Finally, we analyze the performance of those precarious bodies, characterized by the preeminence of a racialization dispositive that involves a process of alterification and unequal distribution and administration of that exposure to precariousness.

Article

Artículo

bodys tactics strategys social conflict power cuerpos tácticas estrategias conflicto social poder CIENCIAS SOCIALES CIENCIAS SOCIALES

The body of knowledge

Lourdes Pacheco (2021)

In the present paper discusses the exclusion of the body performed by modern science and tradition in the body of scientific knowledge became an epistemological obstacle. Women were considered structured by the body, desires and pulsions in both men were self-rated as marked by reason, objectivity and neutrality. The incorporation of women in science led him to discuss the tenets of science, the silencing of the body and the recognition of subjectivity. Knowledge from the bodies of women set out another way to know. Violate the legitimacy of science male domination because their construction process does not occur in the separation of the world, but in proximity to him.

Article

Artículo

Epistemology body feminism Epistemología cuerpo feminismo CIENCIAS SOCIALES CIENCIAS SOCIALES

Color pattern and body size variation in live Aspidoscelis costatus costatus (Squamata: Teiidae) from a protected enclave in southern Mexico

ALDO GOMEZ BENITEZ Oswaldo Hernández Gallegos Brittany Lovell Pelagie Kadia JAMES MARTIN WALKER (2020)

Coloración en la lagartija Aspidoscelis costatus costatus

Whiptail lizards in the sexlineatus species group (genus Aspidoscelis) in North America represent some of the most challenging patterns of variation in the North American herpetofauna. The range of color patterns in these populations is based on individual, ontogenetic, sexual, seasonal, and/or geographic variation. We studied representatives of a population of Western Mexico Whiptail (A. costatus costatus) from a protected private enclave of approximately 0.27 ha in the municipality and city of Ixtapan de la Sal, Estado de México, México. We captured 50 lizards in 2016 and 24 in 2018, most of which we photographed ex situ and a few in situ. These photographs revealed that a variety of age/size related dorsal and ventral patterns were consistently present. Males progressed through five stages of dorsal pattern changes from pale stripes, dark intervening fields, no spots to spots, and diverse pale configurations set in a black ground color. Females in this population showed similar changes but did not lose striping as they grew. Ontogenetic changes in ventral color patterns were also apparent, with males becoming more colorful than females. The adaptive significance of extensive color pattern variation in this urban population of A. c. costatus warrants further study.

Article

adaptive significance Balsas Basin Whiptail body size dorsal coloration Mexican lizards ontogeny spots stripes ventral coloration BIOLOGÍA Y QUÍMICA

Other masculinity: Body and dance practices

Karla Jeanette Chacón Reynosa Raquel Hernández Gómez (2016)

The main objective of this article is to identify and analyze the exercise of corporal practices of young men that execute scenic dance in terms linking / separation of what incarnate as men. In the analysis of the constitution from non-hegemonic masculinities dance, we offer three body itineraries are a real cultural field in which confrontations rise to traditional models of masculinity and emerges from them a display of “other practices”: poor, weak, unstable to (re) construct the masculine; This (re) construction fortifies on the performative field of dance, once regarded as a space “feminized” to recognize and resignifying as sand body transformation and embodiment of other male practices: their affections, development of aesthetic appreciation, care physical and bodily experience.

Article

Artículo

Body practices itineraries dance masculinity Prácticas corporales itinerarios danza masculinidades CIENCIAS SOCIALES CIENCIAS SOCIALES

Body Mass Index in Pregnancy Does Not Affect Peroxisome Proliferator-activated Receptor Gamma Promoter Region (-359 to -260) Methylation in the Neonate

RUTH ELIZABETH CASAMADRID VAZQUEZ ARACELI AMAYA CHAVEZ Hugo Mendieta Zerón (2016)

Background: Obesity in pregnancy can contribute to epigenetic changes. Aim: To assess whether body mass index (BMI) in pregnancy is associated with changes in the methylation of the peroxisome proliferator‑activated receptor γ (PPAR) promoter region (−359 to − 260) in maternal and neonatal leukocytes. Subjects and Methods: In this matched, cohort study 41 pregnant women were allocated into two groups: (a) Normal weight (n = 21) and (b) overweight (n = 20). DNA was extracted from maternal and neonatal leukocytes (4000–10,000 cells) in MagNA Pure (Roche) using MagNA Pure LC DNA Isolation Kit 1 (Roche, Germany). Treatment of DNA (2 μg) was performed with sodium bisulfite (EZ DNA Methylation‑Direct™ Kit; Zymo Research). Real‑time quantitative polymerase chain reaction (qPCR) was performed in a LightCycler 2.0 (Roche) using the SYBR® Advantage® qPCR Premix Kit (Clontech). The primers used for PPARg coactivator (PPARG) M3 were 5’‑aagacggtttggtcgatc‑3’ (forward), and5’‑cgaaaaaaaatccgaaatttaa‑3’ (reverse) and those for PPARG unmethylated were: 5’‑gggaagatggtttggttgatt‑3’ (forward) and 5’‑ttccaaaaaaaaatccaaaatttaa‑3’ (reverse). Intergroup differences were calculated using the Mann–Whitney U‑test, and intragroup differences, with the Wilcoxon test (IBM SPSS Statistics for Windows, Version 19.0. Armonk, NY: IBM Corp.). Results: Significant differences were found in BMI, pregestational weight, and postdelivery weight between groups but not in the methylation status of the PPARγ promoter region (−359 to − 260). Conclusion: The PPARγ promoter region (−359 to − 260) in peripheral leukocytes is unlikely to get an obesity‑induced methylation in pregnancy.

Acknowledgments Authors thank the National Council of Science and Technology (CONACYT), México, for the MSc. Scholarship awarded to Ruth Elizabeth Casamadrid Vázquez and Maggie Brunner M.A., for her excellent help with the English style correction. Financial support and sponsorship National Council of Science and Technology (CONACYT), Mexico and Asociación Científica Latina A.C (ASCILA).

Article

Body mass index Methylation Peroxisome proliferator‑activated receptor gamma Pregnancy MEDICINA Y CIENCIAS DE LA SALUD

Evaluación de la resistencia a la fatiga en mezclas asfálticas tibias mediante la viga de flexión a cuatro puntos

Juan Adrián Ramírez Escobar (2021)

Facultad de Ingeniería Civil. Maestría en Infraestructura del Transporte en la Rama de las Vías Terrestres

For more than two decades warm mix asphalt has been a challenging research topic for the production of environmentally sustainable asphalt pavements. Considering environment effects and fast paced asphalt aging, new technologies have emerged to reduce fuel consumption and CO2 emissions, along with an important increment in pavement life expectancy. Thus, the main objective of this study is to qualify such increment when using a prominent warm mix additive. This is achieved, by adding an organic or chemical based additive, capable of reducing the asphalt viscosity, without compromising its adhesive and visco-elastic properties. Consequently, mixing and compaction temperatures decrease below conventional levels. In Mexico, the construction sector shows reluctance to the use of warm mix technologies. It is thought, that the quality and mechanical performance of these mixtures are deficient, moreover, requires an additional cost of the additive. As a result, the use of warm mix technologies has been limited in the country. For that same reason, this research will evaluate and compare warm and hot mix asphalt, from a neutral point of view. Both technologies will be evaluated according to the Mexican Asphalt Association Protocol (Level III), which includes asphalt and aggregate selection, volumetric design, moisture damage resistance test, deformation resistance test and dynamic modulus test. Finally, fatigue laws will be constructed for every type of asphalt mix, in order to determine the number of cycles it resists before failing due to fatigue.

Por más de 20 años las mezclas asfálticas tibias han sido uno de los temas más desafiantes para la producción de pavimentos ambientalmente sustentables. Considerando las implicaciones ambientales y el envejecimiento acelerado de las mezclas asfálticas en caliente, se han desarrollado nuevas tecnologías para reducir el consumo de combustible y las emisiones contaminantes, así como aumentar la vida útil del pavimento. A partir de lo anterior, este estudio tiene como objetivo principal determinar el aumento de la vida útil al emplear una tecnología en tibio. Esto se lleva acabo agregando un aditivo de base orgánica o química, capaz de reducir la viscosidad del asfalto, sin comprometer sus propiedades adhesivas y visco-elásticas. Por consiguiente, permite reducir las temperaturas de mezclado y compactación por debajo de las convencionales. En México, el sector de la construcción muestra renuencia en el uso de las tecnologías en tibio. Se piensa que la calidad y el rendimiento mecánico de estas mezclas son deficientes y además requieren un costo adicional en su elaboración. Por consecuencia, se ha rezagado considerablemente la práctica de esta tecnología en el país. Por esta razón, este trabajo de investigación evaluará de manera imparcial, el desempeño de las mezclas tibias en comparación con las mezclas asfálticas en caliente. Ambas mezclas se evaluarán de acuerdo al protocolo AMAAC Nivel III, el cual incluye la caracterización de materiales, diseño volumétrico, susceptibilidad a la humedad, susceptibilidad a la deformación y módulo dinámico. Para finalizar se construirán leyes de fatiga para cada variante de mezcla asfáltica, con la finalidad de determinar el número de ciclos que resiste antes de fallar por fatiga.

Master thesis

INGENIERÍA Y TECNOLOGÍA FIC-M-2021-0210 Protocolo AMAAC Módulo dinámico Leyes de fatiga Ensayo Fénix

Threatened abortion and gestational diabetes cases in Mexican pregnant women does not change with the FTO rs9939609 presence

María de los Ángeles Martínez Martínez ENEIDA DEL SOCORRO CAMARILLO ROMERO Arturo González Santana Hugo Mendieta Zerón JONNATHAN GUADALUPE SANTILLAN BENITEZ JOSE DE JESUS GARDUÑO GARCIA (2020)

The Obesity-associated fat mass (FTO) gene has been associated to a higher risk of obstetrical complications. The aim of this prospective, cross-sectional and comparative study was to determine if there are clinical or laboratorial differences in pregnant women with the presence/absence of FTO rs9939609 focused on threatened abortion. Pregnant women between 18 to 35 years of age were invited to participate. In all cases, it was obtained the sociodemographic information, anthropometry, clinical laboratories for obstetrical routine check-up, FTO rs9939609 positive expression, and the homeostasis model assessment (HOMA) and the quantitative insulin sensitivity check index (QUICKI) indexes were also calculated. Comparisons of this type of variables between both groups were performed through Student´s T-test. Chi-Square Tests were used to contrast the GDM and threatened miscarriages percentages of cases between both groups. Pearson correlation was performed among the quantitative variables of all the study population. 57 women positive and 52 negative for the FTO rs9939609 presence were included in the study with a Gestational Diabetes Mellitus prevalence of 19.3%. When contrasting the variables by the presence/absence of FTO rs9939609 the p-values were far from being significant. As such, Chi-Square Tests did not show significant statistical difference neither for GDM nor for threatened miscarriage between both groups. Based on these results, the FTO rs9939609 presence did not reflect difference either in GDM or in threatened miscarriage. It was demonstrated in parallel, the utility of the QUICKI index in the metabolic evaluation during pregnancy. In conclusion, in Mexican women, pregnancy evolution and possible appearance of complications is not so determined by the FTO rs9939609 presence but by the overweight with which this physiological state is faced.

Article

Fat mass and obesity-associated gene Chromosome 16 (16q12.2) Abort Gestational Diabetes Mellitus MEDICINA Y CIENCIAS DE LA SALUD

Sonificación interactiva de movimientos para cambiar la percepción corporal: el caso de estudio de yoga

Interactive sonification of movements to change body perception: the case study of yoga

María Concepción Valdez Gastelum (2021)

La sonificación interactiva es un tipo de sonificación que provee una retroalimentación auditiva sobre un conjunto de información resultada de una interacción. Dicho conjunto de información representa datos obtenidos de diversos tipos de dispositivos o sensores, por ejemplo, ángulos de movimiento de las partes del cuerpo mediante una cámara de profundidad. La retroalimentación auditiva se conoce como interacción sonora y ésta se realiza mediante la asociación de las características sonoras (p.ej., tono, timbre) con los datos sensados. Las interacciones sonoras pueden apoyar a la práctica de actividades físicas aportando una guía de movimientos. También, mediante la manipulación de las características sonoras que conforman dicha interacción, es posible cambiar la percepción corporal durante la práctica de actividades físicas. En particular, es importante tener una percepción corporal positiva durante la práctica de yoga ya que esto ayuda a tener una relación más armónica entre cuerpo y mente, y con ello adaptar las prácticas físicas a necesidades individuales. En esta tesis se presenta el diseño de Zens, una interfaz sonificada la cual mediante interacciones sonoras mejora la experiencia de una práctica de yoga. Por otro lado, mediante la manipulación de la variación de frecuencia busca cambiar la percepción corporal y de flexibilidad de los yoguis. Para evaluar la efectividad de Zens en los términos mencionados anteriormente, se realizó una evaluación donde participaron 12 yoguis principiantes. Todos los yoguis realizaron una sesión de yoga, la mitad de ellos utilizando Zens y la otra mitad de manera tradicional siguiendo el sonido de la respiración. Los resultados indican que Zens genera una mejor experiencia de la práctica de yoga, en particular brindan un sentimiento de logro e interés a los yoguis. Además, los resultados obtenidos muestran que no existe un cambio en la percepción de flexibilidad y percepción corporal al variar la frecuencia de las estructuras sonoras.

Interactive sonification is a type of sonification that provides auditory feedback on a set of information resulting from an interaction. This set of information represents data obtained from various types of devices or sensors, for example, angles of movement of body parts using a depth camera. Auditory feedback is known as sound interaction and this is done by associating sound characteristics (e.g., pitch, timbre) with sensed data. Sound interactions can support the practice of physical activities by providing a guide to movements. Also, by manipulating the sound characteristics that make up this interaction, it is possible to change body perception during the practice of physical activities. In particular, it is important to have a positive body perception during the practice of yoga as this helps to have a more harmonious relationship between body and mind, and thereby adapt physical practices to individual needs. This thesis presents the design of Zens, a sonified interface which through sound interactions improves the experience of a yoga practice. On the other hand, by manipulating frequency variation it seeks to change the body perception and flexibility of yogis. To evaluate the effectiveness of Zens in the terms mentioned above, an evaluation was conducted where 12 beginner yogis participated. All the yogis performed a yoga session, half of them using Zens and the other half in a traditional way following the sound of the breath. The results indicate that Zens generates a better experience of yoga practice, in particular providing a feeling of accomplishment and interest to yogis. In addition, the results obtained show that there is no change in the perception of flexibility and body perception by varying the frequency of sound structures.

Master thesis

Sonificación Interactiva, Percepción Corporal, Yoga, Flexibilidad, Variación de Frecuencia Interactive Sonification, Body Perception, Yoga, Flexibility, Dynamic Pitch INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS TECNOLOGÍA DE LOS ORDENADORES ENSEÑANZA CON AYUDA DE ORDENADOR ENSEÑANZA CON AYUDA DE ORDENADOR

Efecto de la irradiancia en la composición bioquímica de las diatomeas Amphora helenensis y Nitzschia thermalis f. curta

Effect of irradiance on the biochemical composition of diatoms Amphora helenensis and Nitzschia thermalis f. curta

Brianda Andrade Moreno (2021)

En las microalgas, la alteración de factores ambientales como la irradiancia influye en el proceso de la fotosíntesis, modifica el crecimiento y metabolismo de las células y produce cambio en la composición bioquímica. El objetivo de esta investigación fue evaluar el efecto de la irradiancia en el crecimiento y la composición bioquímica de las diatomeas Nitzschia thermalis f. curta y Amphora helenensis. Se realizaron cultivos monoespecíficos de cada especie de diatomea y se mantuvieron por triplicado con cinco niveles de irradiancia (50, 100, 150, 200 y 250 µmol m–2 s–1). Durante la fase exponencial y estacionaria, se evaluó el crecimiento, la composición bioquímica a través de métodos espectrofotométricos, la actividad fotosintética por fluorescencia de la clorofila y la composición de ácidos grasos por cromatografía de gases. En N. thermalis f. curta la tasa de crecimiento incrementó en los mayores valores de irradiancias y durante la fase exponencial aumentó el peso orgánico. Para N. thermalis f. curta la irradiancia de 200 μmol m-2 s-1 produjo los mayores contenidos de proteínas en la fase estacionaria, mientras que los mayores contenidos de los carbohidratos y lípidos se presentaron durante la fase exponencial. El contenido de clorofila a y c de N. thermalis f. curta incrementaron en las bajas irradiancias en la fase estacionaria, mientras que el contenido de carotenos aumentó con las altas irradiancias en la fase estacionaria. Para N. thermalis f. curta los mayores valores de la eficiencia fotosintética (α) se encontraron en la irradiancia de 50 µmol m– 2 s– 1, para el índice de saturación lumínica (IK) en 250 µmol m– 2 s– 1 y para la tasa máxima de transporte de electrones (ETRmax) en 200 y 250 µmol m– 2 s– 1. En los ácidos grasos poliinsaturados (PUFAs) para N. thermalis f. curta el ácido graso más abundante fue el ácido eicosapentaenoico (EPA) que incrementó su contenido en la fase estacionaria, sin embargo, no hubo diferencias por efecto de la irradiancia. Para A. helenensis los bajos valores de irradiancia incrementaron la densidad celular y la tasa de crecimiento, sin embargo, el peso seco orgánico no se modificó por efecto de la irradiancia, pero si se incrementó en la fase estacionaria. En A. helenensis en la fase estacionaria se incrementó el contenido de proteínas en irradiancias de 50 y 150 µmol m–2 s–1, mientras que el contenido de carbohidratos aumentó en la irradiancia de 100 µmol m–2 s–1 en la fase exponencial y el contenido de lípidos

In microalgae, the alteration of environmental factors such as irradiance influences the photosynthesis process, modify the growth and metabolism of cells and changes the biochemical composition. this research had the objective of evaluating the effect of irradiance on the growth and biochemical composition of the diatoms Nitzschia thermalis f. curta and Amphora helenensis. Monospecific cultures of each diatom species were maintained in triplicate withijn five irradiance levels (50, 100, 150, 200, and 250 µmol m–2 s–1). During the exponential and stationary growth phase, the biochemical composition was evaluated through spectrophotometric methods, photosynthetic activity by fluorescence of chlorophyll, and fatty acid composition by gas chromatography. In N. thermalis f. curta, the higher irradiances levels increased the growth rate and, in the exponential phase, the organic weight increase. For N. thermalis f. curta the irradiance of 200 μmol m-2 s-1 produced the highest protein contents in the stationary growth phase, while carbohydrates and lipids contents were higher at the exponential growth phase. The chlorophyll a and c contents of N. thermalis f. curta increased in the low irradiances in the stationary growth phase, while the carotene content increased with the high irradiances in the stationary growth phase. For N. thermalis f. curta the highest photosynthetic efficiency (α) values were in the in 50 µmol m– 2 s– 1, for light saturation index (Ik) in 250 µmol m– 2 s– 1, and for maximum electron transport rate (ETRmax) in 200 and 250 µmol m– 2 s– 1. In polyunsaturated fatty acids (PUFAs) for N. thermalis f. curta the most abundant fatty acid was ecoicasapentaenoic acid (EPA), which increased its content in the stationary growth phase; however, no differences were obtained due to the effect of irradiance. For A. helenensis, the low irradiance values increased the cell density and the growth rate; however, the organic dry weight did not change due to the irradiance level used, but it did increase in the stationary growth phase. In A. helenensis, at the stationary growth phase produced an increase in proteins content at 50 and 150 µmol m –2 s –1; while carbohydrates content increased at 100 µmol m – 2 s – 1 at exponential growth phase, and the lipids content increased at irradiance levels of 150 µmol m -2 s-1 in the exponential growth phase. For A. helenensis, the content of chlorophyll a and carotenes increased at low irradiances in the stationary grow

Master thesis

Diatomeas, ácidos grasos poliinsaturados, crecimiento, composición proximal, fotosíntesis, pigmentos. Diatoms, polyunsaturated fatty acids, growth, proximal composition, photosynthesis, pigments. BIOLOGÍA Y QUÍMICA CIENCIAS DE LA VIDA BIOQUÍMICA ACIDOS GRASOS ACIDOS GRASOS

Efecto inhibitorio de dos especies de diatomeas contra Vibrio harveyi, V. alginolyticus y V. campbellii

Inhibitory effect of two diatom species against Vibrio harveyi, V. alginolyticus, and V. campbellii

Juan Carlos Ayala García (2021)

La acuicultura es una de las principales áreas que soportan la producción de alimento para consumo humano. Sin embargo, los cultivos pueden verse afectados por la presencia de bacterias patógenas entre las que destacan las del género Vibrio, las cuáles pueden ocasionar pérdidas totales en los cultivos. Por ello, es necesario contar con métodos eficaces que permitan controlar las bacterias tipo Vibrio en los sistemas de cultivo. El objetivo de este trabajo fue evaluar el efecto inhibitorio de las diatomeas Nitzschia thermalis f. kurta y Navicula cf. subinflatoides contra las bacterias patógenas de importancia acuícola, a saber, Vibrio campbellii, V. alginolyticus y V. harveyi. Para cumplir el objetivo, se realizaron retos de inhibición, para lo que se emplearon cultivos monoespecíficos, no axénicos y por triplicado en medio “f” a una densidad inicial de 1x105 células mL-1 para cada especie de diatomea. Los cultivos se inocularon con una concentración inicial de 1x102 Vibrio mL-1 para cada especie Vibrio spp. de manera individual. Como tratamientos control, se utilizaron para cada especie de diatomea cultivos en similares condiciones a las antes descritas, pero sin la adición de Vibrio y cultivos de cada especie de Vibrio en medio “f” sin células de diatomeas. Los tratamientos fueron analizados durante las fases exponencial y estacionaria del crecimiento, para evaluar la densidad celular de las diatomeas, conteo de bacterias heterotróficas y cuantificación de la densidad de Vibrio spp. Para cada tratamiento experimental, se tomaron volúmenes apropiados para evaluar el peso seco, composición proximal, pigmentos, fotosíntesis y perfil de ácidos grasos. Se evaluaron diferencias significativas en el crecimiento de N. subinflatoides y N. thermalis al ser cocultivadas con las tres especies de Vibrio spp. (p < 0.05). N. subinflatoides y N. thermalis inhiben el crecimiento de las tres especies de Vibrio durante la fase exponencial de crecimiento. Se evaluaron diferencias significativas en la concentración de las tres especies de Vibrio con respecto al tiempo (p < 0.05). El contenido de bacterias heterotróficas se presentó en todos los tratamientos en el orden de 106 y 107 UFC ml-1, lo que muestra que el efecto inhibitorio de las diatomeas es selectivo para las tres especies de Vibrio evaluadas. El peso seco orgánico presentó diferencias significativas por la adición de las tres especies de Vibrio spp. durante la fase exponencial (p < 0.05) de N. subinflatoides....

Aquaculture is one of the main areas that support the production of food for human consumption. However, crops can be affected by pathogenic bacteria, among which those of the genus Vibrio stand out and can cause total losses in the crops. Therefore, it is necessary to have effective control methods that allow controlling Vibrio-type bacteria in culture systems. The objective of this work was to evaluate the inhibitory effect of the diatoms Nitzschia thermalis f. kurta and Navicula cf. subinflatoides against pathogenic bacteria of aquaculture importance, namely, Vibrio campbellii, V. alginolyticus, and V. harveyi. To achieve the objective, inhibition challenges were performed, for which monospecific, non-axenic, and triplicate cultures were used in medium "f" an initial density of 1x105 cells mL-1 for each diatom species. The cultures were inoculated with an initial concentration of 1x102 Vibrio mL-1 for each Vibrio spp. individually. As a control treatment, cultures under similar conditions to those described above, but without the addition of Vibrio, were used for each diatom species and cultures of each Vibrio species in "f" medium without diatom cells. The treatments were analyzed during the exponential and stationary phases of growth to evaluate the cell density of diatoms, heterotrophic bacteria count, and quantification of the density of Vibrio spp. For each experimental treatment, they were taken necessary to evaluate the dry weight, proximal composition, pigments, photosynthesis, and fatty acid profile. Significant differences in the growth of N. subinflatoides and N. thermalis were evaluated when cocultivated with the three Vibrio spp. species (p < 0.05). N. subinflatoides and N. thermalis inhibit the growth of three Vibrio species during the exponential phase of growth. Significant differences were evaluated in the concentration of the three Vibrio species with respect to time (p < 0.05). The content of heterotrophic bacteria was presented in all treatments in the order of 106 and 107 CFU ml-1, which shows the inhibitory effect of diatoms is selective for the three Vibrio species evaluated. The organic dry weight showed significant differences due to the addition of Vibrio spp. during the exponential phase (p < 0.05) of N. subinflatoides. The presence of the three Vibrio spp. species showed significant differences in the proximal composition of N. subinflatoides and N. thermalis during the exponential and stationary growth phases (p < 0.05)...

Master thesis

Acuicultura, diatomeas, Vibrio, efecto inhibitorio, Navicula subinflatoides, Nitzschia thermalis composición bioquímica, fotosíntesis, composición de ácidos grasos Aquaculture, diatoms, Vibrio, inhibitory effect, Navicula subinflatoides, Nitzschia thermalis, biochemical composition, photosynthesis, fatty acid composition BIOLOGÍA Y QUÍMICA CIENCIAS DE LA VIDA MICROBIOLOGÍA MICROBIOLOGÍA MICROBIOLOGÍA